produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Manage your exceptions in Python like a PRO

A linter to manage all your python exceptions and try/except blocks (limited only for those who like dinosaurs).

Guilherme Latrova 353 Dec 31, 2022
HeadHunter parser

HHparser Description Program for finding work at HeadHunter service Features Find job Parse vacancies Dependencies python pip geckodriver firefox Inst

memphisboy 1 Oct 30, 2021
Simple tool for creating changelogs

Description Simple utility for quickly generating changelogs, assuming your commits are ordered as they should be. This tool will simply log all lates

2 Jan 05, 2022
Conveniently measures the time of your loops, contexts and functions.

Conveniently measures the time of your loops, contexts and functions.

Maciej J Mikulski 79 Nov 15, 2022
Check username

Checker-Oukee Check username It checks the available usernames and creates a new account for them Doesn't need proxies Create a file with usernames an

4 Jun 05, 2022
Michael Vinyard's utilities

Install vintools To download this package from pypi: pip install vintools Install the development package To download and install the developmen

Michael Vinyard 2 May 22, 2022
Functional UUIDs for Python.

🏷️FUUID stands for Functional Universally Unique IDentifier. FUUIDs are compatible with regular UUIDs but are naturally ordered by generation time, collision-free and support succinct representations

Phil Demetriou 147 Oct 27, 2022
Aggregating gridded data (xarray) to polygons

A package to aggregate gridded data in xarray to polygons in geopandas using area-weighting from the relative area overlaps between pixels and polygons.

Kevin Schwarzwald 42 Nov 09, 2022
A quick username checker to see if a username is available on a list of assorted websites.

A quick username checker to see if a username is available on a list of assorted websites.

Maddie 4 Jan 04, 2022
a tool for annotating table

table_annotate_tool a tool for annotating table motivated by wiki2bio,we create a tool to annoate all types of tables,this tool can annotate a table w

wisdom under lemon trees 4 Sep 23, 2021
Dynamic key remapper for Wayland Window System, especially for Sway

wayremap Dynamic keyboard remapper for Wayland. It works on both X Window Manager and Wayland, but focused on Wayland as it intercepts evdev input and

Kay Gosho 50 Nov 29, 2022
A python package containing all the basic functions and classes for python. From simple addition to advanced file encryption.

A python package containing all the basic functions and classes for python. From simple addition to advanced file encryption.

PyBash 11 May 22, 2022
✨ Une calculatrice totalement faite en Python par moi, et en français.

Calculatrice ❗ Une calculatrice totalement faite en Python par moi, et en français. 🔮 Voici une calculatrice qui vous permet de faire vos additions,

MrGabin 3 Jun 06, 2021
Animation retargeting tool for Autodesk Maya. Retargets mocap to a custom rig with a few clicks.

Animation Retargeting Tool for Maya A tool for transferring animation data and mocap from a skeleton to a custom rig in Autodesk Maya. Installation: A

Joaen 63 Jan 06, 2023
Generates a random prnt.sc link and display image.

Generates a random prnt.sc link and display image.

Emirhan 3 Oct 08, 2021
Build capture utility for Linux

CX-BUILD Compilation Database alternative Build Prerequisite the CXBUILD uses linux system call trace utility called strace which was customized. So I

GLaDOS (G? L? Automatic Debug Operation System) 3 Nov 03, 2022
pydsinternals - A Python native library containing necessary classes, functions and structures to interact with Windows Active Directory.

pydsinternals - Directory Services Internals Library A Python native library containing necessary classes, functions and structures to interact with W

Podalirius 36 Dec 14, 2022
Export watched content from Tautulli to the Letterboxd CSV Import Format

Export watched content from Tautulli to the Letterboxd CSV Import Format

Evan J 5 Aug 31, 2022
API for obtaining results from the Beery-Bukenica test of the visomotor integration development (VMI) 4th edition.

VMI API API for obtaining results from the Beery-Bukenica test of the visomotor integration development (VMI) 4th edition. Install docker-compose up -

Victor Vargas Sandoval 1 Oct 26, 2021
EVE-NG tools, A Utility to make operations with EVE-NG more friendly.

EVE-NG tools, A Utility to make operations with EVE-NG more friendly. Also it support different snapshot operations with same style as Libvirt/KVM

Bassem Aly 8 Jan 05, 2023