produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Modeling Category-Selective Cortical Regions with Topographic Variational Autoencoders

Modeling Category-Selective Cortical Regions with Topographic Variational Autoencoders Getting Started Install requirements with Anaconda: conda env c

T. Andy Keller 4 Aug 22, 2022
Adding two matrix from scratch using python.

Adding-two-matrix-from-scratch-using-python. Here, I have take two matrix from user and add it without using any library. I made this program from scr

Sachin Vinayak Dabhade 4 Sep 24, 2021
A tool for testing improper put method vulnerability

Putter-CUP A tool for testing improper put method vulnerability Usage :- python3 put.py -f live-subs.txt Result :- The result in txt file "result.txt"

Zahir Tariq 6 Aug 06, 2021
Utility to play with ADCS, allows to request tickets and collect information about related objects.

certi Utility to play with ADCS, allows to request tickets and collect information about related objects. Basically, it's the impacket copy of Certify

Eloy 185 Dec 29, 2022
Install, run, and update apps without root and only in your home directory

Qube Apps Install, run, and update apps in the private storage of a Qube. Build and install in Qubes Get the code: git clone https://github.com/micahf

Micah Lee 26 Dec 27, 2022
Helpful functions for use alongside the rich Python library.

🔧 Rich Tools A python package with helpful functions for use alongside with the rich python library. 󠀠󠀠 The current features are: Convert a Pandas

Avi Perl 14 Oct 14, 2022
A quick random name generator

Random Profile Generator USAGE & CREDITS Any public or priavte demonstrative usage of this project is strictly prohibited, UNLESS WhineyMonkey10 (http

2 May 05, 2022
Customized python validations.

A customized python validations.

Wilfred V. Pine 2 Apr 20, 2022
Pyfunctools is a module that provides functions, methods and classes that help in the creation of projects in python

Pyfunctools Pyfunctools is a module that provides functions, methods and classes that help in the creation of projects in python, bringing functional

Natanael dos Santos Feitosa 5 Dec 22, 2022
Writing Alfred copy/paste scripts in Python

Writing Alfred copy/paste scripts in Python This repository shows how to create Alfred scripts in Python. It assumes that you using pyenv for Python v

Will Fitzgerald 2 Oct 26, 2021
A python module to manipulate XCode projects

This module can read, modify, and write a .pbxproj file from an Xcode 4+ projects. The file is usually called project.pbxproj and can be found inside the .xcodeproj bundle. Because some task cannot b

Ignacio Calderon 1.1k Jan 02, 2023
A python script to generate wallpaper

wallpaper eits Warning You need to set the path to Robot Mono font in the source code. (Settings are in the main function) Usage A script that given a

Henrique Tsuyoshi Yara 5 Dec 02, 2021
API Rate Limit Decorator

ratelimit APIs are a very common way to interact with web services. As the need to consume data grows, so does the number of API calls necessary to re

Tomas Basham 575 Jan 05, 2023
A simple API that will return a key-value pair of randomly generated UUID

A simple API that will return a key-value pair of randomly generated UUID. Key will be a timestamp and value will be UUID. While the server is running, whenever the API is called, it should return al

Pius Lucky 2 Jan 18, 2022
A library for interacting with Path of Exile game and economy data, and a unique loot filter generation framework.

wraeblast A library for interfacing with Path of Exile game and economy data, and a set of item filters geared towards trade league players. Filter Ge

David Gidwani 29 Aug 28, 2022
Retrying is an Apache 2.0 licensed general-purpose retrying library, written in Python, to simplify the task of adding retry behavior to just about anything.

Retrying Retrying is an Apache 2.0 licensed general-purpose retrying library, written in Python, to simplify the task of adding retry behavior to just

Ray Holder 1.9k Dec 29, 2022
iOS Snapchat parser for chats and cached files

ParseSnapchat iOS Snapchat parser for chats and cached files Tested on Windows and Linux install required libraries: pip install -r requirements.txt c

11 Dec 05, 2022
Analyze metadata of your Python project.

Analyze metadata of your Python projects Setup: Clone repo py-m venv venv (venv) pip install -r requirements.txt specify the folders which you want to

Pedro Monteiro de Carvalho e Silva Prado 1 Nov 10, 2021
Simple yet flexible natural sorting in Python.

natsort Simple yet flexible natural sorting in Python. Source Code: https://github.com/SethMMorton/natsort Downloads: https://pypi.org/project/natsort

Seth Morton 712 Dec 23, 2022
Random Name and Slug Generator

Random Name and Slug Generator

Alexander Lukanin 104 Nov 30, 2022