produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Simple web index to use bloom filter for Pwned Passwords

pwbloom Simple web index to use bloom filter for Pwned Passwords The index.py runs a simple CGI web service checking passwords with a bloom filter for

Hanno Böck 4 Nov 23, 2021
Airspy-Utils is a small software collection to help with firmware related operations on Airspy HF+ devices.

Airspy-Utils Airspy-Utils is a small software collection to help with firmware related operations on Airspy HF+ devices on Linux (and other free syste

Dhiru Kholia 11 Oct 04, 2022
A program to convert celcius to faranheit. made with python

Temp-Converter What is Temp-Converter Temp-Converter is little program made with pyhton to convert celcius to faranheit. Needed A python interpreter P

Chandula Janith 0 Nov 27, 2021
Michael Vinyard's utilities

Install vintools To download this package from pypi: pip install vintools Install the development package To download and install the developmen

Michael Vinyard 2 May 22, 2022
Extract the download URL from OneDrive or SharePoint share link and push it to aria2

OneDriveShareLinkPushAria2 Extract the download URL from OneDrive or SharePoint share link and push it to aria2 从OneDrive或SharePoint共享链接提取下载URL并将其推送到a

高玩梁 262 Jan 08, 2023
jsoooooooon derulo - Make sure your 'jason derulo' is featured as the first part of your json data

jsonderulo Make sure your 'jason derulo' is featured as the first part of your json data Install: # python pip install jsonderulo poetry add jsonderul

jesse 3 Sep 13, 2021
Conveniently measures the time of your loops, contexts and functions.

Conveniently measures the time of your loops, contexts and functions.

Maciej J Mikulski 79 Nov 15, 2022
The Black shade analyser and comparison tool.

diff-shades The Black shade analyser and comparison tool. AKA Richard's personal take at a better black-primer (by stealing ideas from mypy-primer) :p

Richard Si 10 Apr 29, 2022
This project is a set of programs that I use to create a README.md file.

This project is a set of programs that I use to create a README.md file.

Tom Dörr 223 Dec 24, 2022
Format Norminette Output!

Format Norminette Output!

7 Apr 19, 2022
Python based tool to extract forensic info from EventTranscript.db (Windows Diagnostic Data)

EventTranscriptParser EventTranscriptParser is python based tool to extract forensically useful details from EventTranscript.db (Windows Diagnostic Da

P. Abhiram Kumar 24 Nov 18, 2022
Casefy (/keɪsfaɪ/) is a lightweight Python package to convert the casing of strings

Casefy (/keɪsfaɪ/) is a lightweight Python package to convert the casing of strings. It has no third-party dependencies and supports Unicode.

Diego Miguel Lozano 12 Jan 08, 2023
It is a tool that looks for a specific username in social networks

It is a tool that looks for a specific username in social networks

MasterBurnt 6 Oct 07, 2022
EVE-NG tools, A Utility to make operations with EVE-NG more friendly.

EVE-NG tools, A Utility to make operations with EVE-NG more friendly. Also it support different snapshot operations with same style as Libvirt/KVM

Bassem Aly 8 Jan 05, 2023
A library from RCTI+ to handle RabbitMQ tasks (connect, send, receive, etc) in Python.

Introduction A library from RCTI+ to handle RabbitMQ tasks (connect, send, receive, etc) in Python. Requirements Python =3.7.3 Pika ==1.2.0 Aio-pika

Dali Kewara 1 Feb 05, 2022
Utility to add/remove licenses to/from source files

Utility to add/remove licenses to/from source files. Supports processing any combination of globs, files, and directories (recurse). Pruning options allow skipping non-licensing files.

Eduardo Ponce Mojica 2 Jan 29, 2022
Delete all of your forked repositories on Github

Fork Purger Delete all of your forked repositories on Github Installation Install using pip: pip install fork-purger Exploration Under construc

Redowan Delowar 29 Dec 17, 2022
Software to help automate collecting crowdsourced annotations using Mechanical Turk.

Video Crowdsourcing Software to help automate collecting crowdsourced annotations using Mechanical Turk. The goal of this project is to enable crowdso

Mike Peven 1 Oct 25, 2021
A Container for the Dependency Injection in Python.

Python Dependency Injection library aiodi is a Container for the Dependency Injection in Python. Installation Use the package manager pip to install a

Denis NA 3 Nov 25, 2022
Simple python module to get the information regarding battery in python.

Battery Stats A python3 module created for easily reading the current parameters of Battery in realtime. It reads battery stats from /sys/class/power_

Shreyas Ashtamkar 5 Oct 21, 2022