Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

Related tags

File & Path UtilitiesGetTransTool
Overview

GetTransTool Package

There are four types of methods to extract longest transcript or longest CDS regeion with longest transcript from transcripts fasta file or GTF file.

  • 1.Extract longest transcript from gencode transcripts fasta file.

  • 2.Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

  • 3.Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

  • 4.Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

Install

$ pip install GetTransTool

Usage

1. get longest transcript from gencode transcripts fasta file:

help infomation:

$ GetLongestTransFromGencode -h
usage: GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans.fa

Get longest transcripts from gencode transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your transcripts file with ".gz" format. (gencode.vM28.transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans_gencode.fa
Your job is running, please wait...
Your job is done!
Running with 32.33 seconds!

there will be three files produced including name_changed.fa, longest_transcripts_info.csv, longest_trans_gencode.fa.

name_changed.fa:

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

longest_transcripts_info.csv:

this is the longest transcripts exon length information.

fullname,gene_name,translength
snoZ196_ENSMUSG00002074855.1_ENSMUST00020182568.1_35,snoZ196,35
snoZ159_ENSMUSG00002075734.1_ENSMUST00020182611.1_87,snoZ159,87
n-R5s93_ENSMUSG00000119639.1_ENSMUST00000240071.1_119,n-R5s93,119
...

longest_trans_gencode.fa:

this is the filtered longest transcript fasta file.

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

2. Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database:

help infomation:

$ GetLongestTransFromGTF -h
usage: GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans.fa

Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl/gencode)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 159.51 seconds!

there will be three files produced including longest_transcripts_info.csv, longest_trans.gtf, longest_trans_ensembl.fa.

longest_transcripts_info.csv:

,transcript_length,gene_name
snoZ196_ENSG00000281780_ENST00000625269_snoRNA,89,snoZ196
hsa-mir-423_ENSG00000266919_ENST00000586878_lncRNA,94,hsa-mir-423
hsa-mir-1253_ENSG00000272920_ENST00000609567_lncRNA,105,hsa-mir-1253
...

longest_trans.gtf:

this is the gtf information for the longest transcripts.

1	havana	gene	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
1	havana	transcript	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; tag "basic"; transcript_support_level "1";
1	havana	exon	11869	12227	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "1"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002234944"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	12613	12721	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00003582793"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	13221	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "3"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002312635"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	gene	14404	29570	.	-	.	gene_id "ENSG00000227232"; gene_version "5"; gene_name "WASH7P"; gene_source "havana"; gene_biotype "unprocessed_pseudogene";

longest_trans_ensembl.fa:

>DDX11L1_ENSG00000223972_ENST00000456328_transcribed_unprocessed_pseudogene
GTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTC
TCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGA
TGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTG
...

for ucsc:

$ GetLongestTransFromGTF --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_trans_ucsc.fa

3. Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

help infomation:

$ GetCDSLongestFromGencode -h
usage: GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your protein-coding transcripts file with ".gz" format. (gencode.vM28.pc_transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans_gencode.fa
Your job is running, please wait...
Your job is done! 
Running with 17.67 seconds!

there will be four files produced including name_changed.fa, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_gencode.fa.

name_changed.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_transcripts_info.csv:

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_trans_gencode.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

4. Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

help infomation:

$ GetCDSLongestFromGTF -h
usage: GetCDSLongestFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o cdslongestfile, --outfile cdslongestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGTF  --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 152.38 seconds!

there will be four files produced including CDS_longest_trans.gtf, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_ensembl.fa.

CDS_longest_trans.gtf:

1	ensembl_havana	gene	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
1	havana	transcript	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003812156"; exon_version "1"; tag "basic";
1	havana	exon	65520	65573	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813641"; exon_version "1"; tag "basic";
1	havana	CDS	65565	65573	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	start_codon	65565	65567	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	69037	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813949"; exon_version "1"; tag "basic";
1	havana	CDS	69037	70005	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	stop_codon	70006	70008	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65520	65564	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	three_prime_utr	70009	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	ensembl_havana	gene	450740	451678	.	-	.	gene_id "ENSG00000284733"; gene_version "2"; gene_name "OR4F29"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
1227,ZZZ3_ENSG00000036549_ENST00000370798,2468,486,ZZZ3
173,ZZZ3_ENSG00000036549_ENST00000433749,603,430,ZZZ3
...

longest_cds_transcripts_info.csv:

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
8883,ZZEF1_ENSG00000074755_ENST00000381638,11466,135,ZZEF1
1716,ZYX_ENSG00000159840_ENST00000322764,2228,80,ZYX
...

longest_cds_trans_gencode.fa:

>OR4F5_ENSG00000186092_ENST00000641515_61_1038_2618
CCCAGATCTCTTCAGTTTTTATGCCTCATTCTGTGAAAATTGCTGTAGTCTCTTCCAGTT
ATGAAGAAGGTAACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAAC
TCTATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTC
...

for ucsc:

$ GetCDSLongestFromGTF  --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_cds_trans_ensembl.fa

END

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

Owner
laojunjun
路漫漫其修远兮 吾将上下而求索
laojunjun
GitHub Repository
Various technical documentation, in electronically parseable format

a-pile-of-documentation Various technical documentation, in electronically parseable format. You will need Python 3 to run the scripts and programs in

Jonathan Campbell 2 Nov 20, 2022
CSV-Handler written in Python3

CSVHandler This code allows you to work intelligently with CSV files. A file in CSV syntax is converted into several lists, which are combined in a to

Max Tischberger 1 Jan 13, 2022
A simple bulk file renamer, written in python.

Python File Editor A simple bulk file renamer, written in python. There are two functions, the bulk rename and the bulk file extention change. Bulk Fi

Sam Bloomfield 2 Dec 22, 2021
pydicom - Read, modify and write DICOM files with python code

pydicom is a pure Python package for working with DICOM files. It lets you read, modify and write DICOM data in an easy "pythonic" way.

DICOM in Python 1.5k Jan 04, 2023
Simple Python File Manager

This script lets you automatically relocate files based on their extensions. Very useful from the downloads folder !

Aimé Risson 22 Dec 27, 2022
Sheet Data Image/PDF-to-CSV Converter

Sheet Data Image/PDF-to-CSV Converter

Quy Truong 5 Nov 22, 2021
CleverCSV is a Python package for handling messy CSV files.

CleverCSV is a Python package for handling messy CSV files. It provides a drop-in replacement for the builtin CSV module with improved dialect detection, and comes with a handy command line applicati

The Alan Turing Institute 1k Dec 19, 2022
BREP : Binary Search in plaintext and gzip files

BREP : Binary Search in plaintext and gzip files Search large files in O(log n) time using binary search. We support plaintext and Gzipped files. Benc

Arnaud de Saint Meloir 5 Dec 24, 2021
A JupyterLab extension that allows opening files and directories with external desktop applications.

A JupyterLab extension that allows opening files and directories with external desktop applications.

martinRenou 0 Oct 14, 2021
A Python script to backup your favorite Discord gifs

About the project Discord recently felt like it would be a good idea to limit the favorites to 250, which made me lose most of my gifs... Luckily for

4 Aug 03, 2022
OneDriveExplorer - A command line and GUI based application for reconstructing the folder strucure of OneDrive from the UserCid.dat file

OneDriveExplorer - A command line and GUI based application for reconstructing the folder strucure of OneDrive from the UserCid.dat file

Brian Maloney 100 Dec 13, 2022
This program can help you to move and rename many files at once

This program can help you to rename and save many files in a folder in seconds, but don't give the same name to files, it can delete both files.

João Assalim 1 Oct 10, 2022
An easy-to-use library for emulating code in minidump files.

dumpulator Note: This is a work-in-progress prototype, please treat it as such. An easy-to-use library for emulating code in minidump files. Example T

Duncan Ogilvie 362 Dec 31, 2022
A python module to parse text files with contains secret variables.

A python module to parse text files with contains secret variables.

0 Dec 05, 2022
Measure file similarity in a many-to-many fashion

Mesi Mesi is a tool to measure the similarity in a many-to-many fashion of long-form documents like Python source code or technical writing. The outpu

GatorEducator 3 Feb 02, 2022
Generates a clean .txt file of contents of a 3 lined csv file

Generates a clean .txt file of contents of a 3 lined csv file. File contents is the .gml file of some function which stores the contents of the csv as a map.

Alex Eckardt 1 Jan 09, 2022
Lumar - Smart File Creator

Lumar is a free tool for creating and managing files. With Lumar you can quickly create any type of file, add a file content and file size. With Lumar you can also find out if Photoshop or other imag

Paul - FloatDesign 3 Dec 10, 2021
Ini adalah program python untuk mengubah background foto dalam 1 folder, tidak perlu satu satu

Myherokuapp my web drive You can see my web drive and can request film/Application do you want in here my blog you can visit my blog RemBg ini adalah

XnuxersXploitXen 13 Dec 01, 2022
Object-oriented file system path manipulation

path (aka path pie, formerly path.py) implements path objects as first-class entities, allowing common operations on files to be invoked on those path

Jason R. Coombs 1k Dec 28, 2022
A simple library for temporary storage of small files

TemporaryStorage An simple library for temporary storage of small files. Navigation Install Usage In Python console As a standalone application List o

2 Apr 17, 2022