AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Related tags

Data Analysisbioinformaticscomparisondnarnasecondary-structurenucleic-acids
Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

These can be installed by typing in the command prompt either :

./setup

or

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

  • structures followed by secondary structures written in dotbracket format
  • files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]]

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 "> 
$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 "> 
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

You might also like...
The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

null 1 Dec 9, 2021
Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

Sebastian Schäfer 10 Dec 8, 2022
Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

John McCambridge 79 Sep 20, 2022
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

null 2 Jul 22, 2022
WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

Michael Milton 1 Oct 26, 2021
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

Najibulloh Asror 2 Feb 10, 2022
My first Python project is a simple Mad Libs program.
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

Carson Johnson 1 Dec 10, 2021
simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

aliaksandr-master 0 Jan 26, 2022
Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

Yap Khai Chuen 7 Dec 15, 2022
Comments
  • Allow comparison with not folded secondary structure

    Allow comparison with not folded secondary structure

    User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

    • Give a default distance value to unfolded vs folded structure (worst solution)
    • Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:
      • How to manage with enhancement #7 ? Take the largest ? Shortest ?
      • It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.
    • Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.
    enhancement 
    opened by GitHuBinet 0
  • Different length support and optimal alignment

    Different length support and optimal alignment

    Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.

    enhancement 
    opened by GitHuBinet 0
  • Is the algorithm time consuming ?

    Is the algorithm time consuming ?

    Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

    • [ ] Think about the possibility of improving this bracket search.
    • [ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)
    • [x] #6
    • [ ] Test the algorithm with this new feature
    question 
    opened by GEC-git 0
  • G-quadruplex/pseudoknot comprehension

    G-quadruplex/pseudoknot comprehension

    Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

    The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

    • [ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))
    • [x] #5
    enhancement invalid 
    opened by GEC-git 0
Releases(v0.9-pre-release)

  • v0.9-pre-release(Oct 28, 2022)

    Pre-release content

    https://github.com/GEC-git/AptaMat

    • Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2
    • main script AptaMat.py
    • README.MD edited and published
    • Beta AptaMat logo edited and published

    Contributors

    • @GEC-git contributed in https://github.com/GEC-git/AptaMat
    • @GitHuBinet contributed in https://github.com/GEC-git/AptaMat

    Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release

    Source code(tar.gz)
    Source code(zip)
Owner
GEC UTC
We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.
GEC UTC
GitHub Repository
The Master's in Data Science Program run by the Faculty of Mathematics and Information Science

The Master's in Data Science Program run by the Faculty of Mathematics and Information Science is among the first European programs in Data Science and is fully focused on data engineering and data a

Amir Ali 2 Jun 17, 2022
Finds, downloads, parses, and standardizes public bikeshare data into a standard pandas dataframe format

Finds, downloads, parses, and standardizes public bikeshare data into a standard pandas dataframe format.

Brady Law 2 Dec 01, 2021
pandas: powerful Python data analysis toolkit

pandas is a Python package that provides fast, flexible, and expressive data structures designed to make working with "relational" or "labeled" data both easy and intuitive.

pandas 36.4k Jan 03, 2023
Used for data processing in machine learning, and help us to construct ML model more easily from scratch

Used for data processing in machine learning, and help us to construct ML model more easily from scratch. Can be used in linear model, logistic regression model, and decision tree.

ShawnWang 0 Jul 05, 2022
Convert tables stored as images to an usable .csv file

Convert an image of numbers to a .csv file This Python program aims to convert images of array numbers to corresponding .csv files. It uses OpenCV for

711 Dec 26, 2022
International Space Station data with Python research 🌎

International Space Station data with Python research 🌎 Plotting ISS trajectory, calculating the velocity over the earth and more. Plotting trajector

Facundo Pedaccio 41 Jun 16, 2022
This is a python script to navigate and extract the FSD50K dataset

FSD50K navigator This is a script I use to navigate the sound dataset from FSK50K.

sweemeng 2 Nov 23, 2021
Geospatial data-science analysis on reasons behind delay in Grab ride-share services

Grab x Pulis Detailed analysis done to investigate possible reasons for delay in Grab services for NUS Data Analytics Competition 2022, to be found in

Keng Hwee 6 Jun 07, 2022
Functional tensors for probabilistic programming

Funsor Funsor is a tensor-like library for functions and distributions. See Functional tensors for probabilistic programming for a system description.

208 Dec 29, 2022
PyChemia, Python Framework for Materials Discovery and Design

PyChemia, Python Framework for Materials Discovery and Design PyChemia is an open-source Python Library for materials structural search. The purpose o

Materials Discovery Group 61 Oct 02, 2022
Transform-Invariant Non-Negative Matrix Factorization

Transform-Invariant Non-Negative Matrix Factorization A comprehensive Python package for Non-Negative Matrix Factorization (NMF) with a focus on learn

EMD Group 6 Jul 01, 2022
TE-dependent analysis (tedana) is a Python library for denoising multi-echo functional magnetic resonance imaging (fMRI) data

tedana: TE Dependent ANAlysis TE-dependent analysis (tedana) is a Python library for denoising multi-echo functional magnetic resonance imaging (fMRI)

136 Dec 22, 2022
Learn machine learning the fun way, with Oracle and RedBull Racing

Red Bull Racing Analytics Hands-On Labs Introduction Are you interested in learning machine learning (ML)? How about doing this in the context of the

Oracle DevRel 55 Oct 24, 2022
Wafer Fault Detection - Wafer circleci with python

Wafer Fault Detection Problem Statement: Wafer (In electronics), also called a slice or substrate, is a thin slice of semiconductor, such as a crystal

Avnish Yadav 14 Nov 21, 2022
EOD Historical Data Python Library (Unofficial)

EOD Historical Data Python Library (Unofficial) https://eodhistoricaldata.com Installation python3 -m pip install eodhistoricaldata Note Demo API key

Michael Whittle 20 Dec 22, 2022
An Indexer that works out-of-the-box when you have less than 100K stored Documents

U100KIndexer An Indexer that works out-of-the-box when you have less than 100K stored Documents. U100K means under 100K. At 100K stored Documents with

Jina AI 7 Mar 15, 2022
Semi-Automated Data Processing

Perform semi automated exploratory data analysis, feature engineering and feature selection on provided dataset by visualizing every possibilities on each step and assisting the user to make a meanin

Arun Singh Babal 1 Jan 17, 2022
An Aspiring Drop-In Replacement for NumPy at Scale

Legate NumPy is a Legate library that aims to provide a distributed and accelerated drop-in replacement for the NumPy API on top of the Legion runtime. Using Legate NumPy you do things like run the f

Legate 502 Jan 03, 2023
Detecting Underwater Objects (DUO)

Underwater object detection for robot picking has attracted a lot of interest. However, it is still an unsolved problem due to several challenges. We take steps towards making it more realistic by ad

27 Dec 12, 2022
Using approximate bayesian posteriors in deep nets for active learning

Bayesian Active Learning (BaaL) BaaL is an active learning library developed at ElementAI. This repository contains techniques and reusable components

ElementAI 687 Dec 25, 2022