AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

These can be installed by typing in the command prompt either :

./setup

or

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

  • structures followed by secondary structures written in dotbracket format
  • files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]] 

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 ">
$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 ">
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

You might also like...
The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

My first Python project is a simple Mad Libs program.
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

Comments
  • Allow comparison with not folded secondary structure

    Allow comparison with not folded secondary structure

    User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

    • Give a default distance value to unfolded vs folded structure (worst solution)
    • Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:
      • How to manage with enhancement #7 ? Take the largest ? Shortest ?
      • It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.
    • Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.
    enhancement 
    opened by GitHuBinet 0
  • Different length support and optimal alignment

    Different length support and optimal alignment

    Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.

    enhancement 
    opened by GitHuBinet 0
  • Is the algorithm time consuming ?

    Is the algorithm time consuming ?

    Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

    • [ ] Think about the possibility of improving this bracket search.
    • [ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)
    • [x] #6
    • [ ] Test the algorithm with this new feature
    question 
    opened by GEC-git 0
  • G-quadruplex/pseudoknot comprehension

    G-quadruplex/pseudoknot comprehension

    Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

    The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

    • [ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))
    • [x] #5
    enhancement invalid 
    opened by GEC-git 0
Releases(v0.9-pre-release)
  • v0.9-pre-release(Oct 28, 2022)

    Pre-release content

    https://github.com/GEC-git/AptaMat

    • Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2
    • main script AptaMat.py
    • README.MD edited and published
    • Beta AptaMat logo edited and published

    Contributors

    • @GEC-git contributed in https://github.com/GEC-git/AptaMat
    • @GitHuBinet contributed in https://github.com/GEC-git/AptaMat

    Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release

    Source code(tar.gz)
    Source code(zip)
Owner
GEC UTC
We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.
GEC UTC
Mortgage-loan-prediction - Show how to perform advanced Analytics and Machine Learning in Python using a full complement of PyData utilities

Mortgage-loan-prediction - Show how to perform advanced Analytics and Machine Learning in Python using a full complement of PyData utilities. This is aimed at those looking to get into the field of D

Joachim 1 Dec 26, 2021
Using Data Science with Machine Learning techniques (ETL pipeline and ML pipeline) to classify received messages after disasters.

Using Data Science with Machine Learning techniques (ETL pipeline and ML pipeline) to classify received messages after disasters.

1 Feb 11, 2022
Probabilistic reasoning and statistical analysis in TensorFlow

TensorFlow Probability TensorFlow Probability is a library for probabilistic reasoning and statistical analysis in TensorFlow. As part of the TensorFl

3.8k Jan 05, 2023
Python Practicum - prepare for your Data Science interview or get a refresher.

Python-Practicum Python Practicum - prepare for your Data Science interview or get a refresher. Data Data visualization using data on births from the

Jovan Trajceski 1 Jul 27, 2021
Mining the Stack Overflow Developer Survey

Mining the Stack Overflow Developer Survey A prototype data mining application to compare the accuracy of decision tree and random forest regression m

1 Nov 16, 2021
Aggregating gridded data (xarray) to polygons

A package to aggregate gridded data in xarray to polygons in geopandas using area-weighting from the relative area overlaps between pixels and polygons. Check out the binder link above for a sample c

Kevin Schwarzwald 42 Nov 09, 2022
A set of functions and analysis classes for solvation structure analysis

SolvationAnalysis The macroscopic behavior of a liquid is determined by its microscopic structure. For ionic systems, like batteries and many enzymes,

MDAnalysis 19 Nov 24, 2022
Orchest is a browser based IDE for Data Science.

Orchest is a browser based IDE for Data Science. It integrates your favorite Data Science tools out of the box, so you don’t have to. The application is easy to use and can run on your laptop as well

Orchest 3.6k Jan 09, 2023
Nobel Data Analysis

Nobel_Data_Analysis This project is for analyzing a set of data about people who have won the Nobel Prize in different fields and different countries

Mohammed Hassan El Sayed 1 Jan 24, 2022
Detailed analysis on fraud claims in insurance companies, gives you information as to why huge loss take place in insurance companies

Insurance-Fraud-Claims Detailed analysis on fraud claims in insurance companies, gives you information as to why huge loss take place in insurance com

1 Jan 27, 2022
Python ELT Studio, an application for building ELT (and ETL) data flows.

The Python Extract, Load, Transform Studio is an application for performing ELT (and ETL) tasks. Under the hood the application consists of a two parts.

Schlerp 55 Nov 18, 2022
MotorcycleParts DataAnalysis python

We work with the accounting department of a company that sells motorcycle parts. The company operates three warehouses in a large metropolitan area.

NASEEM A P 1 Jan 12, 2022
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

Carson Johnson 1 Dec 10, 2021
Improving your data science workflows with

Make Better Defaults Author: Kjell Wooding [email protected] This is the git re

Kjell Wooding 18 Dec 23, 2022
OpenARB is an open source program aiming to emulate a free market while encouraging players to participate in arbitrage in order to increase working capital.

Overview OpenARB is an open source program aiming to emulate a free market while encouraging players to participate in arbitrage in order to increase

Tom 3 Feb 12, 2022
A Streamlit web-app for a data-science project that aims to evaluate if the answer to a question is helpful.

How useful is the aswer? A Streamlit web-app for a data-science project that aims to evaluate if the answer to a question is helpful. If you want to l

1 Dec 17, 2021
MetPy is a collection of tools in Python for reading, visualizing and performing calculations with weather data.

MetPy MetPy is a collection of tools in Python for reading, visualizing and performing calculations with weather data. MetPy follows semantic versioni

Unidata 971 Dec 25, 2022
This cosmetics generator allows you to generate the new Fortnite cosmetics, Search pak and search cosmetics!

COSMETICS GENERATOR This cosmetics generator allows you to generate the new Fortnite cosmetics, Search pak and search cosmetics! Remember to put the l

ᴅᴊʟᴏʀ3xᴢᴏ 11 Dec 13, 2022
Falcon: Interactive Visual Analysis for Big Data

Falcon: Interactive Visual Analysis for Big Data Crossfilter millions of records without latencies. This project is work in progress and not documente

Vega 803 Dec 27, 2022
PyStan, a Python interface to Stan, a platform for statistical modeling. Documentation: https://pystan.readthedocs.io

PyStan PyStan is a Python interface to Stan, a package for Bayesian inference. Stan® is a state-of-the-art platform for statistical modeling and high-

Stan 229 Dec 29, 2022