AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Last update: Nov 03, 2022

Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

NumPy
scipy

These can be installed by typing in the command prompt either :

./setup

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

structures followed by secondary structures written in dotbracket format
files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]]

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 ">

$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 ">

$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

1 Dec 9, 2021

Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

10 Dec 8, 2022

Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

79 Sep 20, 2022

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

2 Jul 22, 2022

WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

1 Oct 26, 2021

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

2 Feb 10, 2022

My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

1 Dec 10, 2021

simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

0 Jan 26, 2022

Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

7 Dec 15, 2022

Comments

Allow comparison with not folded secondary structure
User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

Give a default distance value to unfolded vs folded structure (worst solution)

Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:

How to manage with enhancement #7 ? Take the largest ? Shortest ?

It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.

Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.

enhancement
opened by GitHuBinet 0
Different length support and optimal alignment

Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.
enhancement

opened by GitHuBinet 0
Is the algorithm time consuming ?
Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

[ ] Think about the possibility of improving this bracket search.

[ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)

[x] #6

[ ] Test the algorithm with this new feature

question
opened by GEC-git 0
G-quadruplex/pseudoknot comprehension
Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

[ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))

[x] #5

enhancement invalid
opened by GEC-git 0

Releases(v0.9-pre-release)

v0.9-pre-release(Oct 28, 2022)
Pre-release content

https://github.com/GEC-git/AptaMat

Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2

main script AptaMat.py

README.MD edited and published

Beta AptaMat logo edited and published

Contributors

@GEC-git contributed in https://github.com/GEC-git/AptaMat

@GitHuBinet contributed in https://github.com/GEC-git/AptaMat

Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release
Source code(tar.gz)
Source code(zip)

Owner

GEC UTC

We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.

GitHub Repository

Efficient matrix representations for working with tabular data

70 Dec 14, 2022

Pizza Orders Data Pipeline Usecase Solved by SQL, Sqoop, HDFS, Hive, Airflow.

PizzaOrders_DataPipeline There is a Tony who is owning a New Pizza shop. He knew that pizza alone was not going to help him get seed funding to expand

4 Jun 05, 2022

PostQF is a user-friendly Postfix queue data filter which operates on data produced by postqueue -j.

11 Nov 24, 2022

Fast, flexible and easy to use probabilistic modelling in Python.

Please consider citing the JMLR-MLOSS Manuscript if you've used pomegranate in your academic work! pomegranate is a package for building probabilistic

3k Jan 02, 2023

Automatic earthquake catalog building workflow: EQTransformer + Siamese EQTransformer + PickNet + REAL + HypoInverse

Automatic regional-scale earthquake catalog building workflow: EQTransformer + Siamese EQTransforme

9 Nov 27, 2022

PyPSA: Python for Power System Analysis

1 Python for Power System Analysis Contents 1 Python for Power System Analysis 1.1 About 1.2 Documentation 1.3 Functionality 1.4 Example scripts as Ju

758 Dec 30, 2022

Python implementation of Principal Component Analysis

Principal Component Analysis Principal Component Analysis (PCA) is a dimension-reduction algorithm. The idea is to use the singular value decompositio

1 Nov 06, 2021

Hg002-qc-snakemake - HG002 QC Snakemake

HG002 QC Snakemake To Run Resources and data specified within snakefile (hg002QC

2 Feb 16, 2022

DefAP is a program developed to facilitate the exploration of a material's defect chemistry

DefAP is a program developed to facilitate the exploration of a material's defect chemistry. A large number of features are provided and rapid exploration is supported through the use of autoplotting

6 Oct 25, 2022

An extension to pandas dataframes describe function.

pandas_summary An extension to pandas dataframes describe function. The module contains DataFrameSummary object that extend describe() with: propertie

450 Dec 30, 2022

Analytical view of olist e-commerce in Brazil

Analysis of E-Commerce Public Dataset by Olist The objective of this project is to propose an analytical view of olist e-commerce in Brazil. For this

1 Jan 11, 2022

Advanced Pandas Vault — Utilities, Functions and Snippets (by @firmai).

PandasVault ⁠— Advanced Pandas Functions and Code Snippets The only Pandas utility package you would ever need. It has no exotic external dependencies

374 Jan 07, 2023

BioMASS - A Python Framework for Modeling and Analysis of Signaling Systems

Mathematical modeling is a powerful method for the analysis of complex biological systems. Although there are many researches devoted on produ

22 Dec 27, 2022

Unsub is a collection analysis tool that assists libraries in analyzing their journal subscriptions.

About Unsub is a collection analysis tool that assists libraries in analyzing their journal subscriptions. The tool provides rich data and a summary g

9 Nov 16, 2022

A Pythonic introduction to methods for scaling your data science and machine learning work to larger datasets and larger models, using the tools and APIs you know and love from the PyData stack (such as numpy, pandas, and scikit-learn).

This tutorial's purpose is to introduce Pythonistas to methods for scaling their data science and machine learning work to larger datasets and larger models, using the tools and APIs they know and lo

102 Nov 10, 2022