AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Related tags

Data Analysisbioinformaticscomparisondnarnasecondary-structurenucleic-acids
Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

These can be installed by typing in the command prompt either :

./setup

or

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

  • structures followed by secondary structures written in dotbracket format
  • files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]]

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 "> 
$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 "> 
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

You might also like...
The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

null 1 Dec 9, 2021
Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

Sebastian Schäfer 10 Dec 8, 2022
Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

John McCambridge 79 Sep 20, 2022
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

null 2 Jul 22, 2022
WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

Michael Milton 1 Oct 26, 2021
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

Najibulloh Asror 2 Feb 10, 2022
My first Python project is a simple Mad Libs program.
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

Carson Johnson 1 Dec 10, 2021
simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

aliaksandr-master 0 Jan 26, 2022
Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

Yap Khai Chuen 7 Dec 15, 2022
Comments
  • Allow comparison with not folded secondary structure

    Allow comparison with not folded secondary structure

    User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

    • Give a default distance value to unfolded vs folded structure (worst solution)
    • Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:
      • How to manage with enhancement #7 ? Take the largest ? Shortest ?
      • It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.
    • Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.
    enhancement 
    opened by GitHuBinet 0
  • Different length support and optimal alignment

    Different length support and optimal alignment

    Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.

    enhancement 
    opened by GitHuBinet 0
  • Is the algorithm time consuming ?

    Is the algorithm time consuming ?

    Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

    • [ ] Think about the possibility of improving this bracket search.
    • [ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)
    • [x] #6
    • [ ] Test the algorithm with this new feature
    question 
    opened by GEC-git 0
  • G-quadruplex/pseudoknot comprehension

    G-quadruplex/pseudoknot comprehension

    Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

    The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

    • [ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))
    • [x] #5
    enhancement invalid 
    opened by GEC-git 0
Releases(v0.9-pre-release)

  • v0.9-pre-release(Oct 28, 2022)

    Pre-release content

    https://github.com/GEC-git/AptaMat

    • Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2
    • main script AptaMat.py
    • README.MD edited and published
    • Beta AptaMat logo edited and published

    Contributors

    • @GEC-git contributed in https://github.com/GEC-git/AptaMat
    • @GitHuBinet contributed in https://github.com/GEC-git/AptaMat

    Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release

    Source code(tar.gz)
    Source code(zip)
Owner
GEC UTC
We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.
GEC UTC
GitHub Repository
Analyzing Earth Observation (EO) data is complex and solutions often require custom tailored algorithms.

eo-grow Earth observation framework for scaled-up processing in Python. Analyzing Earth Observation (EO) data is complex and solutions often require c

Sentinel Hub 18 Dec 23, 2022
Convert monolithic Jupyter notebooks into Ploomber pipelines.

Soorgeon Join our community | Newsletter | Contact us | Blog | Website | YouTube Convert monolithic Jupyter notebooks into Ploomber pipelines. soorgeo

Ploomber 65 Dec 16, 2022
Detailed analysis on fraud claims in insurance companies, gives you information as to why huge loss take place in insurance companies

Insurance-Fraud-Claims Detailed analysis on fraud claims in insurance companies, gives you information as to why huge loss take place in insurance com

1 Jan 27, 2022
Python for Data Analysis, 2nd Edition

Python for Data Analysis, 2nd Edition Materials and IPython notebooks for "Python for Data Analysis" by Wes McKinney, published by O'Reilly Media Buy

Wes McKinney 18.6k Jan 08, 2023
Very basic but functional Kakuro solver written in Python.

kakuro.py Very basic but functional Kakuro solver written in Python. It uses a reduction to exact set cover and Ali Assaf's elegant implementation of

Louis Abraham 4 Jan 15, 2022
Intake is a lightweight package for finding, investigating, loading and disseminating data.

Intake: A general interface for loading data Intake is a lightweight set of tools for loading and sharing data in data science projects. Intake helps

Intake 851 Jan 01, 2023
A data structure that extends pyspark.sql.DataFrame with metadata information.

MetaFrame A data structure that extends pyspark.sql.DataFrame with metadata info

Invent Analytics 8 Feb 15, 2022
Recommendations from Cramer: On the show Mad-Money (CNBC) Jim Cramer picks stocks which he recommends to buy. We will use this data to build a portfolio

Backtesting the "Cramer Effect" & Recommendations from Cramer Recommendations from Cramer: On the show Mad-Money (CNBC) Jim Cramer picks stocks which

Gábor Vecsei 12 Aug 30, 2022
CPSPEC is an astrophysical data reduction software for timing

CPSPEC manual Introduction CPSPEC is an astrophysical data reduction software for timing. Various timing properties, such as power spectra and cross s

Tenyo Kawamura 1 Oct 20, 2021
A CLI tool to reduce the friction between data scientists by reducing git conflicts removing notebook metadata and gracefully resolving git conflicts.

databooks is a package for reducing the friction data scientists while using Jupyter notebooks, by reducing the number of git conflicts between different notebooks and assisting in the resolution of

dataroots 86 Dec 25, 2022
InDels analysis of CRISPR lines by NGS amplicon sequencing technology for a multicopy gene family.

CRISPRanalysis InDels analysis of CRISPR lines by NGS amplicon sequencing technology for a multicopy gene family. In this work, we present a workflow

2 Jan 31, 2022
Churn prediction with PySpark

It is expected to develop a machine learning model that can predict customers who will leave the company.

3 Aug 13, 2021
Business Intelligence (BI) in Python, OLAP

Open Mining Business Intelligence (BI) Application Server written in Python Requirements Python 2.7 (Backend) Lua 5.2 or LuaJIT 5.1 (OML backend) Mong

Open Mining 1.2k Dec 27, 2022
Data Analysis for First Year Laboratory at Imperial College, London.

Data Analysis for First Year Laboratory at Imperial College, London. For personal reference only, and to reference in lab reports and lab books.

Martin He 0 Aug 29, 2022
A lightweight interface for reading in output from the Weather Research and Forecasting (WRF) model into xarray Dataset

xwrf A lightweight interface for reading in output from the Weather Research and Forecasting (WRF) model into xarray Dataset. The primary objective of

National Center for Atmospheric Research 43 Nov 29, 2022
Learn machine learning the fun way, with Oracle and RedBull Racing

Red Bull Racing Analytics Hands-On Labs Introduction Are you interested in learning machine learning (ML)? How about doing this in the context of the

Oracle DevRel 55 Oct 24, 2022
Single machine, multiple cards training; mix-precision training; DALI data loader.

Template Script Category Description Category script comparison script train.py, loader.py for single-machine-multiple-cards training train_DP.py, tra

2 Jun 27, 2022
A Python package for modular causal inference analysis and model evaluations

Causal Inference 360 A Python package for inferring causal effects from observational data. Description Causal inference analysis enables estimating t

International Business Machines 506 Dec 19, 2022
Single-Cell Analysis in Python. Scales to >1M cells.

Scanpy – Single-Cell Analysis in Python Scanpy is a scalable toolkit for analyzing single-cell gene expression data built jointly with anndata. It inc

Theis Lab 1.4k Jan 05, 2023
Analytical view of olist e-commerce in Brazil

Analysis of E-Commerce Public Dataset by Olist The objective of this project is to propose an analytical view of olist e-commerce in Brazil. For this

Gurpreet Singh 1 Jan 11, 2022